pyk [2019-06-28 11:43:31]

pyruvate kinase, glycolytic enzyme

Locus: BSU29180

Isoelectric point: 4.88

Molecular weight: 62.00 kDa

Protein length: 585 aa

Gene length: 1758 bp

Function: catabolic enzyme in glycolysis

Product: pyruvate kinase

Essential: no

E.C.: 2.7.1.40

Synonyms: pykA

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Carbon core metabolism → Glycolysis
• Groups of genes → Phosphoproteins → Phosphorylation on a Ser residue

Gene

Coordinates: 2,984,788 → 2,986,545

Phenotypes of a mutant

• unable to grow with non-PtsI carbohydrates (such as glucitol or glycerol) as single carbon source
• suppression of ftsZ(ts) mutation (reverted by addition of pyruvate) PubMed

The protein

Catalyzed reaction/ biological activity

• ADP + phosphoenolpyruvate -→ ATP + pyruvate
• The reaction is irreversible under physiological conditions

Protein family

• PEP-utilizing enzyme family (according to Swiss-Prot) pyruvate kinase family, (C-terminal section: PEP-utilizing enzyme family)

Modification

• phosphorylation on Ser36 PubMed, PubMed, phosphorylation on Ser536 or Ser546 PubMed, please note that the Ser is not on position 536 but rather at 538

Cofactors

• Mg2+, K+

Effectors of protein activity

• Activated by PEP (Hill Coefficient 1,8) PubMed PubMed
• Allosterically activated by AMP PubMed
• Activation by r5p and ADP PubMed
• Inhibition by ADP and f16bp in high concentrations; and ATP PubMed

Structure

• 2E28 (Geobacillus stearothermophilus) PubMed

Localization

• cytoplasm PubMed

Additional information

• The enzyme is a tetramer with four active sites PubMed
• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: pfkA-pyk-ytzA
  Description: PubMed

  Regulation

  • twofold induced by glucose PubMed

Biological materials

Mutant

• GP589 (pyk::cat), available in Jörg Stülke's lab, PubMed
• GP600 (pyk::erm), available in Jörg Stülke's lab, PubMed
• GP1745: BSB1 pyk::aphA3, available in Jörg Stülke' lab
• BKE29180 (Δpyk::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGGTTCACTTCCTTCT, downstream forward: _UP4_TAATTACAGGTGAAAATGGA
• BKK29180 (Δpyk::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGGTTCACTTCCTTCT, downstream forward: _UP4_TAATTACAGGTGAAAATGGA

Expression vectors

• expression in E. coli, N-terminal His-tag: pGP1100 (in pWH844), available in Jörg Stülke's lab, PubMed
• expression in B. subtilis, native protein: pGP1411 (in pBQ200), available in Jörg Stülke's lab
• expression in B. subtilis, N-terminal Strep-tag: pGP1409 (in pGP380), available in Jörg Stülke's lab
• expression in B. subtilis, C-terminal Strep-tag: pGP1410 (in pGP382), available in Jörg Stülke's lab

LacZ fusion

• see ''pfkA

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab, PubMed

Labs working on this gene/protein

• Jörg Stülke, University of Göttingen, Germany Homepage

References

Loading